G-Quadruplex
K+ is sandwiched between 2 tetrad layers, connecting to 8 oxygen atoms in two layers of G4. This is the most stable configuration. Contrast this with Na+, which is small enough to slip inside the tetrad plane, reducing the sandwich effect, and creating more unstable topologies. In this way, stable G-quadruplexes act as a potassium sensor. Less stable G-quadruplex configurations indicate a change in normal intracellular ion balance. Normally, K+ is high, and Na+ is low in the intracellular environment.
Now
let’s look at the formula for G4. In 1XAV, the sequence is:
5′‑TGAGGGTGGGTAGGGTGGGTAA‑3′
The
formula is [3G + (1 or 2)N] X 4. Each consecutive G forms a new layer (same colour). 3Gs multipled by 4 tracts create 3 layers of tetrads. Think of each consecutive G as going upwards up to level 3, and the first G in the next tract dips down into level 1 again.
The minimal number of K+ ions required is n-1, where n is the number of layers. For a 3-layered tetrad, the minimal number of K+ is 2, as seen in 1XAV.
You can see this clearly with the RCSB PDB viewer without the distractions of atomic detail.
This is an idealized experimental model – in reality, the number of Gs and Ns can vary, creating different sized loops outside of the tetrad, and shifting tetrad conformations. Additional K+ may be present for bonding outside of the central region, creating higher-order structures.
Higher
number of consecutive G’s produce dynamic configuration via register
polymorphisms. Gs are constantly shifting between the various options available.
Beyond a threshold of consecutive G’s, higher-order structures such as G-wires
can form. Extra G’s outside of each tetrad pair with each other. Additionally, unequal
numbers of consecutive Gs across the tracts create more asymmetrical and heterogeneous
structures.
The
length of N between the G tracts forms a loop, and can vary in number,
forming various sized loops. Again, heterogenous number of N’s will create more
irregular structures. So the combination (x)G(y)N and (z)K+ determines the symmetry, stability and complexity of the resulting structure.
G-wire
models (Marzano et al., 2020).
G-quadruplexes
serve important biological functions as regulatory switches. Over 40% of human
gene promoters contain G4-promoting sequences. Previously, G4s were thought to
be transcriptional repressors, blocking access to promoters. Recently, CRISPR
studies have demonstrated that G4s can act as positive transcriptional
regulators.
Human
telomeres consist of thousands of TTAGGG repeats, facilitating G4 formation. This
creates a structural cap that shields the chromosome end, preventing aberrant
recombination. Through regulation points, G4 can unfold to allow telomerase to
access the telomere for extension. When extension is completed, the region is refolded
back into G4, returning to a protected state. G4 also occurs in different types
of RNA for translational and non-coding regulation.
In
summary, the stability of G4 structures depends on 1, ion balance, and 2,
sequence patterns of x(G)y(N). Both these factors are dysregulated in cancer
contexts.
Cancer
cells usually display abnormal ion balance, such as elevated intracellular Na+,
correlating with the stage of malignancy. This is due to various complex
factors. 3 mechanisms are highlighted here:
- Acid-extrusion
mechanism. Since cancer cells undergo aerobic glycolysis via the Warburg effect
and accumulate acid (H+), cancer cells must pump protons out via the
sodium-hydrogen exchanger NHE1. This antiporter pumps out one proton for every
Na+ it brings into the cell.
- Metastatic
cancer cells often acquire voltage-gated sodium channels, or VGSCs. This allows
a constant leakage of Na+ into the cell, upregulating proton pumping out of the
cell.
- Cancer
cells require amino acids to build proteins. To import amino acids, they rely
on the sodium-coupled symporters, harnessing the sodium gradient (high in EC,
low in IC) to drag amino acids into the cell.
In
cancer cells, dysregulation of the intracellular K+/Na+ ratio destabilizes G4
structures in oncogene promoters. This drives uncontrolled expression of oncogenes
such as c-MYC, KRAS, and HIF1α. Conversely, aberrant G4 stabilization may
occur in other contexts (through mutations and ion balance shifts favouring
stable G4), suppressing tumor suppressor genes.
Cancer-related
mutations preferentially occur in G4 enriched regions. Since G4 regions are
protected regions, they are less accessible to certain DNA repair mechanisms. Additionally,
guanine is the most easily oxidized base among the 4 bases accumulating
oxidative damage as 8-oxo-guanine.
Hence,
G4 structures are a promising therapeutic target, such as the c-MYC G4
structures. c-MYC codes for a transcription factor that controls the
expression of hundreds of genes involved in proliferation and immune evasion. c-MYC
is dysregulated in >50% of all human cancers. This will be explored in a
separate post.
Further
reading
Doray, B., Liu, L., Lee, W. S., Jennings,
B. C., & Kornfeld, S. (2021). Inactivation of the three GGA genes in HeLa
cells partially compromises lysosomal enzyme sorting. FEBS open bio, 11(2),
367–374. https://doi.org/10.1002/2211-5463.13040
Esain-Garcia, I., Kosiol, N., Marsico, L., Tannahill, D., & Balasubramanian, S. (2024). G-quadruplex DNA structure is a positive regulator of MYC transcription. Proceedings of the National Academy of Sciences USA, 121(7), e2320240121. https://doi.org/10.1073/pnas.2320240121
Rankin, S., Reszka, A. P., Huppert, J., Zloh, M., Parkinson, G. N., Todd, A. K., Ladame, S., Balasubramanian, S., & Neidle, S. (2005). Putative DNA quadruplex formation within the human c-kit oncogene. Journal of the American Chemical Society, 127(30), 10584–10589. https://doi.org/10.1021/ja050823u
Tu, L., Hao, Y., Li, R., et al. (2025). Sequence determinants of G-quadruplex thermostability. Nucleic Acids Research, PMC12650012. https://doi.org/10.1093/nar/gkae1157